Часто задаваемые вопросы


Модерирование включено, после обработки специалистом ваш вопрос публикуется в данном разделе.

ФИО*
E-mail*
вопрос*
Защита от автоматического заполнения
CAPTCHA
Введите цифры с картинки*:

Максим Мне нужен олиг в котором 3 штрих конец заблокирован так, чтобы полимеразная реакция при ПЦР не шла. То есть гидроксил на 3 штрих конце должен быть чем-то испорчен, или удален. Можете ли вы такой олиг сделать, скажем 0.5 наномолей, и сколько это будет стоить?
Ответ: Можно. Стандартный способ блокировки - 3' фосфат. Стоимость введения - 440 рублей.
Глухова Любовь Бориосовна Здравствуйте. Спасибо за ответ. Подскажите ещё, пожалуйста, можете ли вы синтезировать вот эти штучки: 5'–GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT–3' 3'–H 2 N-CCCGACCA-PO 4 –5' =)
Ответ: Можем
Глухова Любовь Бориосвна Здравствуйте. Подскажите есть ли у вас праймеры для сиквенирования вставки из плазмиды pJET 1.2/blunt Cloning Vector или их нужно высылать вместе с пробами?
Ответ: Праймеры лучше выслать (из расчета 3.2 пкмоль на один сиквенс) вместе с образцами. Либо прислать названия праймеров и/или их последовательность.
Глазова Ольга Владимировна Здравствуйте! В наборе для выделения НК "К-Сорб" есть пункт №4.4 "... элюирующего раствора, предварительно прогретого до 70С ..." Подскажите, этот прогрев необходимо осуществлять каждый раз перед использованием раствора или достаточно прогреть раствор перед первым использованием и далее использовать без прогрева?
Ответ: Необходимо нагревать элюирующий раствор каждый раз перед  элюцией. Можно предварительно отлить необходимое количество раствора в отдельную пробирку.
Копытова Дарья Владимировна Можете ли вы синтезировать следующий олигонуклеотид 5' (rApp) AGA TCG GAA GAG CGG TTC AG (ddC) 3'?
Ответ: К сожалению, нет. Мы не умеем синтезировать:

AppA
Пучков Михаил Здравствуйте! Имеет ли государственную регистрацию и сертификат 8-капиллярный генетический анализатор «НАНОФОР-05». Спасибо.
Ответ: В настоящее время 8-капиллярный генетический анализатор «НАНОФОР-05» проходит процедуру клинических испытаний.
Слепнева Татьяна Владимировна Добрый день! Какие из наборов ДЛЯ ВЫЯВЛЕНИЯ ДНК/РНК ВОЗБУДИТЕЛЕЙ ОПАСНЫХ И ОСОБО ОПАСНЫХ ИНФЕКЦИЙ МЕТОДОМ ПЦР В РЕАЛЬНОМ ВРЕМЕНИ имеют регистрационные удостоверения?
Ответ: В настоящее время наборы "ОМ-Скрин" проходят процедуру государственной регистрации.
Адигамова Софья Антоновна Здравствуйте, подскажите можно ли использовать наборы реагентов "РНК-онкомаркеры" на аппарате ДТ-лайт
Ответ: Да, можно. Необходимо использовать каналы детекции флуоресценции, соответствующие красителям, приведённым в инструкциях к наборам.
Гость Нужна ли очистка олигонуклеотидов? Какой процент примесей содержится в неочищенном олигонуклеотиде?
Ответ: Синтез олигонуклеотидов осуществляется на автоматическом синтезаторе амидофосфитным методом. Суть метода заключается в последовательном наращивании олигонуклеотидной цепи соответствующим активированным мономером. Уровень чистоты целевого олигонуклеотида определяется эффективностью присоединения мономера к полинуклеотидной цепи на каждой стадии синтеза.

Амидофосфитный метод позволяет проводить конденсацию на каждой стадии в среднем на 98.5%. Таким образом, для N-звенного олигонуклеотида необходимо провести N циклов присоединения нуклеотида к растущей олигонуклеотидной цепи, а значит, конечный выход продукта будет равен:

(0,985) N-1 х 100%


Таким образом, чем больше длина олигонуклеотида, тем выше процент примесей. Так, для 15-звенного олигонуклеотида минимальный конечный выход составит около 81%, а для 35-звенного олигонуклеотида - 60%.
Чем длиннее Ваш олигонуклеотид, тем более необходима его очистка.
Гость Можно ли использовать наборы реагентов производства ЗАО «Синтол» на других real-time амплификаторах?
Ответ: В основном, да. Исключение составляют случаи, когда формат наборов не соответствует формату амплификатора (например, набор, раскапанный в стрипы, не может использоваться в приборе роторного типа Roter-Gene 6000/Q).

Кроме того, наборы «SNP-Скрин», в которых продукты ПЦР-РВ, детектируемые на 2 различных каналах детекции флуоресценции, отличаются лишь на 1 нуклеотид, корректно работают только на приборах, поддерживающих температуру в пробирках с высокой точностью.
Гость Можно ли использовать на приборе «АНК-32М» наборы реагентов других производителей?
Ответ: Да, «АНК-32М» - прибор «открытого» типа, т.е. позволяет использовать наборы реагентов как отечественного, так и импортного производства.